1995;269:1885C1888. to get rid of unwanted, damaged, or harmful cells (13, 19, 23). Many different stimuli can induce apoptosis, including the binding of certain ligands to cell surface death receptors, removal of extracellular survival signals, steroid hormones, DNA damage, and viral contamination (1, 6). Regardless of the stimulus, however, cell killing is carried out by a family of well-conserved cysteine proteases called caspases (Cys Asp protease) (21, 29). Caspases are synthesized as inactive or weakly active proenzymes that have to be cleaved at conserved Asp residues to form the active tetrameric protease (30, 34). A combinatorial approach has been developed to determine the precise specificity of each caspase (28). It has been proposed that caspases may function in a proteolytic cascade consisting of initiator caspases that process and thereby activate downstream effector caspases. According to this model, effector caspases are thought to cleave proteins that are essential for maintaining cellular structure and function (21, 28, 29). A key question that is still incompletely comprehended is usually how caspases are activated in response to many different proapoptotic signals. One important biochemical event during caspase activation is the Amsacrine hydrochloride removal of an inhibitory N-terminal prodomain. This step involves cleavage at specific Asp residues. Many active caspases are able to autoprocess their zymogens and those Amsacrine hydrochloride of other caspases in vitro. However, in most cases it remains to be determined whether the reactions that have been observed in vitro actually occur during apoptosis in vivo. In (((4, 10, 32). These genes have a partially redundant function and kill by activating a caspase pathway (33, 36). Although each gene is able Amsacrine hydrochloride to induce apoptosis independently, the regulation and function of these three genes appear to be different. During development, and are specifically expressed in the cells that are doomed to die. and activate different sets of caspases. Two very similar caspases, DCP-1 and drICE, have been previously identified and characterized (7, 8, 22). The two proteins have 57% amino acid identity, and they both have short prodomains, indicating that they may function as effector caspases. One difference between these two proteins is in the N-terminal portions of their p20 subunits: drICE contains a higher number of Ser and Gly residues in this region than DCP-1. DCP-1 Sema3b has enzymological properties very similar to those of CED-3 (22). DCP-1 can induce apoptosis in insect and mammalian cells and apoptosis-like events in a cell-free system. Loss of zygotic function causes larval lethality and melanotic tumors, indicating an essential role of in development (22). function is also required for normal nurse cell death during oogenesis in (17). Overexpression of full-length drICE sensitizes cells to apoptotic stimuli, and an N-terminally truncated version of drICE can induce apoptosis in SL2 cells. Moreover, treatment of SL2 cells with different death inducers results in proteolytic processing of drICE (7). Ectopic expression of cell death genes under the control of eye-specific promoters, such as GMR, is a useful system to define genetic interactions among different components of the cell death pathway in (4, 10, 11, 33). In this study, we have generated transgenic flies that carry either the full-length or truncated forms (without the prodomain) of DCP-1 and drICE under the control of the GMR promoter. We find that expression of Amsacrine hydrochloride a truncated transgene, GMR-N-transgene, GMR-fl-in the developing retina had no obvious effect. Interestingly, GMR-and GMR-flies, suggesting that may function downstream of and and purified with Ni2+ columns as described before (22). A truncated version of drICE, with its N-terminal 28-amino-acid prodomain removed and a six-His tag attached to the C terminus, was generated by PCR using drICE cDNA as the template, with the upstream primer 5GGCAAACATATGGCCCTGGGCTCCGTGGGATCC3 and the downstream primer 5CTCTCACATATGTCAGTGGTGGTGGTGGTGGTGAACCCGTCCGGCTGGAGCCAA3. The PCR product was treated with BL21(ED3) by IPTG (isopropyl–d-thiogalactopyranoside) induction and purified with Ni2+ columns as described before (22). Determination of the substrate specificity of DCP-1. The synthesis and preparation of the positional scanning synthetic combinatorial library used in this study have been described previously, and this library has been used to determine the proteolytic specificities of nine human caspases, CED-3, and cytotoxic T-lymphocyte-derived granzyme B (28). The general structure of the library, Ac-[P4]-[P3]-[P2]-Asp-AMC, permits the determination of caspase amino acid preferences in P2, P3, and P4 positions. Asp is usually kept invariant at P1, owing to the stringent P1 Asp specificity of all caspases, and the fluorogenic AMC moiety was incorporated in the P1 position to monitor proteolysis. The entire library contains 60 mixtures of 400 compounds each (20 20) thus yielding 8,000 distinct peptides, each in triplicate. Each of the 60 mixtures was prepared as a.