Digoxigenin (DIG)-UTP-labelled antisense and sense riboprobes were generated from linearized cDNA plasmids containing cathepsin L cDNA by in vitro transcription using RNA labelling kits, T3 RNA polymerase (Roche). degenerated primers with an oligo (dT) adapter (5CGAGTCGACATCGATCGTTTTTTTTTTTTTTTTT3) in order to amplify the 3 end of cathepsin L cDNA. Finally, a nested PCR used fw-vector1 (5CGCTTTGC CTGACCCTGCTTGC3) and fw-vector2 (5CGCCGTTACAGATCCAAGCTCC3) with a cathepsin L rv2 degenerated primer (5AAGGCCCAGCANGANCCRCA3) in order to amplify the 5 end of cathepsin L cDNA. All PCR products were cloned in pGEM T-easy vector (Promega) and sequenced using the BigDye Terminator v3.0 polymerisation kit G-749 before detection on the ABI Prism 310 Genetic Analyzer (Applied Biosystems). Sequence analysis used the BLAST programs with E=1000 and no filter [14,15]. Cystatin B (GenBank assession number “type”:”entrez-nucleotide”,”attrs”:”text”:”AF542131″,”term_id”:”23344731″,”term_text”:”AF542131″AF542131) cDNA was obtained from a previous study after screening of a cDNA library prepared from total stage 2 [2]. 2.4. Western immunoblotting Leeches were freezed in liquid nitrogen, then crushed in a mortar and finally resuspended in 800 l homogenization buffer (0.1 M Tris-HCl, pH 7.5, 20 mM CaCl2, 20 mM MgCl2 and EDTA-free Complete Protease Inhibitor Cocktail (Roche Applied Science)). Samples were centrifuged at 10 000 g for 20 minutes. 100 l supernatants were mixed 1:1 (v/v) with Laemmli buffer (62.5 mM Tris-HCl, pH 6.8, 1.5% SDS, 10% sucrose, and 0.01% bromophenol blue) and 5% 2-mercaptoethanol. The samples were boiled for 5 minutes prior to loading on SDS-PAGE gel. Stacking gel was 4% Acrylamide:Bis-acrylamide (29:1) in 0.375 M Tris-HCl, pH 6.8 and 0.1% SDS. Resolving gel was 12% Acrylamide:Bis-acrylamide (29:1) in 0.125 M Tris-HCl, pH 8.8 and 0.1% SDS. Gels were polymerised with 10% APS and TEMED. Samples were loaded next to Precision Plus Protein standards (Bio-rad). They were subjected to electrophoresis (100V for 1 hour and 200 V for 3 hours) in 25 mM Tris, pH 8.3, 192 mM glycine, 0.1% SDS buffer and separated proteins were transferred onto nitrocellulose membrane at 0.12 A for 1.5 hour at G-749 room temperature in 25 mM Tris, 192 mM glycine, 15% methanol buffer. The nitrocellulose membrane was preincubated with 1% ovalbumin in 10 mM Tris-HCl, pH 8, 150 mM NaCl buffer for 1 hour to block non specific binding. The membrane was then incubated with anti-D31 and IFO12708 were used for the antimicrobial assays. Heat killed or were washed in phosphate buffer saline (PBS) and then labelled by incubation for 1 hour at 25C in 0.1M NaHCO3, pH 9.6, 0.01 mg/ml FITC (sigma). Bacteria were pelleted at 12,500 for 5 minutes, washed free of unbound fluorochrome with PBS and kept G-749 at ?20C until use. 2.6. Phagocytosis assays Animals were injected individually with 10 l of a solution containing either 109 FITC-labelled or 109 FITC-labelled hybridization and confocal microscopy, leeches were fixed overnight in a solution containing 4 % paraformaldehyde, pH 7.4. After dehydration, animals were embedded in paraplast and 7-m sections were cut, mounted on poly-L-lysine-coated slides, and stored at 4 C until use. 2.8. In situ hybridization Probes Plasmids containing a piece of cathepsin L cDNA (GenBank accession number “type”:”entrez-nucleotide”,”attrs”:”text”:”AF542132″,”term_id”:”23344733″,”term_text”:”AF542132″AF542132) or cystatin B cDNA (GenBank accession number “type”:”entrez-nucleotide”,”attrs”:”text”:”AF542131″,”term_id”:”23344731″,”term_text”:”AF542131″AF542131) were used as templates for the preparation of the probes. Digoxigenin (DIG)-UTP-labelled antisense and sense riboprobes were generated from linearized cDNA plasmids containing cathepsin L cDNA by in vitro transcription using RNA labelling kits, T3 RNA polymerase (Roche). [35S]UTP-labelled antisense and sense riboprobes were generated from linearized cDNA plasmids containing cystatin B cDNA by in vitro transcription using RNA labelling kits, T3 RNA polymerase (Roche) and [35S]UTP (Amersham). or FITC-labelled for 15 minutes at 4C. Pellets were fixed in 3% glutaraldehyde in 0.1 M phosphate buffer, pH 7.4, for 2 hours. After postfixation in 0.1 M osmium tetroxide in the same phosphate buffer, pellets were dehydrated with acetone and embedded in Epon in the conventionnal manner (polymerization at 60C for 48 h). Ultrathin sections (80-90 nm) were cut from the Epon blocks, placed on 200-mesh copper grids, counterstained routinely with uranyl acetate, and lead Rabbit Polyclonal to MBL2 citrate, and observed in a Jeol CX 100 electron microscope. and preprocathepsin L gene, named (Accession number “type”:”entrez-protein”,”attrs”:”text”:”Q8IT42″,”term_id”:”74816143″,”term_text”:”Q8IT42″Q8IT42 in.